Extreme acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a novel coronavirus chargeable for an ongoing human pandemic (COVID-19). There’s a large worldwide effort underway to develop diagnostic reagents, vaccines, and antiviral medication in a bid to decelerate the unfold of the illness and save lives.
One a part of that worldwide effort includes the analysis group working with vegetation, bringing researchers from all around the world along with industrial enterprises to realize the fast provide of protein antigens and antibodies for diagnostic kits, and scalable manufacturing techniques for the emergency manufacturing of vaccines and antiviral medication.
Right here, we take a look at a number of the methods through which vegetation can and are getting used within the combat towards COVID-19.
Alkaliphiles: The Versatile Tools in Biotechnology.
The acute environments inside the biosphere are inhabited by organisms referred to as extremophiles. Lately to Currently, these organisms are attracting quite a lot of curiosity from researchers and industrialists. The motive behind this attraction is especially associated to the need for brand new and environment friendly merchandise of biotechnological significance and human curiosity of understanding nature.
Organisms dwelling in frequent “human-friendly” environments have served humanity for a really very long time, and this has led to exhaustion of the low-hanging “fruits,” a phenomenon witnessed by the diminishing price of recent discoveries. In current occasions by For instance, buying novel merchandise akin to medication from the normal sources has grow to be troublesome and costly. Such challenges along with the essential analysis curiosity have introduced the exploration of beforehand uncared for or unknown teams of organisms. Extremophiles are amongst these teams which have been delivered to focus and garnering a rising significance in biotechnology.
In the previous couple of many years, quite a few extremophiles and their merchandise have gotten their methods into industrial, agricultural, environmental, pharmaceutical, and different biotechnological purposes.Alkaliphiles, organisms which thrive optimally at or above pH 9, are probably the most essential courses of extremophiles. To flourish of their excessive habitats, alkaliphiles developed spectacular structural and practical variations. The excessive pH adaptation gave distinctive biocatalysts which are operationally steady at elevated pH and a number of other different novel merchandise with immense biotechnological software potential.
 EIF1AX Antibody |
| 1-CSB-PA007506GA01HU |
Cusabio |
|
|
- Form: Liquid
- Buffer: PBS with 0.1% Sodium Azide, 50% Glycerol, pH 7.3. -20℃, Avoid freeze / thaw cycles. Antigen Affinity Purified
|
|
Description: A polyclonal antibody against EIF1AX. Recognizes EIF1AX from Human, Mouse, Rat. This antibody is Unconjugated. Tested in the following application: ELISA, WB, IHC |
EIF1AX Antibody |
| 47437-100ul |
SAB |
100ul |
EUR 252.00 |
 EIF1AX antibody |
| 70R-5014 |
Fitzgerald |
50 ug |
EUR 467.00 |
|
Description: Rabbit polyclonal EIF1AX antibody raised against the middle region of EIF1AX |
EIF1AX antibody |
| 70R-17031 |
Fitzgerald |
50 ul |
EUR 435.00 |
|
Description: Rabbit polyclonal EIF1AX antibody |
 EIF1AX siRNA |
| 20-abx915122 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF1AX siRNA |
| 20-abx915123 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
EIF1AX Antibody |
| DF12973 |
Affbiotech |
200ul |
EUR 304.00 |
|
Description: EIF1AX Antibody detects endogenous levels of EIF1AX. |
 EIF1AX Conjugated Antibody |
| C47437 |
SAB |
100ul |
EUR 397.00 |
 EIF1AX cloning plasmid |
| CSB-CL007506HU-10ug |
Cusabio |
10ug |
EUR 233.00 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 435
- Sequence: atgcccaagaataaaggtaaaggaggtaaaaacagacgcaggggtaagaatgagaatgaatctgaaaaaagagaactggtattcaaagaggatggtcaggagtatgctcaggtaatcaaaatgttgggaaatggacggctagaagcaatgtgtttcgatggtgtaaagaggttatg
- Show more
|
|
Description: A cloning plasmid for the EIF1AX gene. |
 EIF1AX Blocking Peptide |
| 33R-4747 |
Fitzgerald |
100 ug |
EUR 180.00 |
|
Description: A synthetic peptide for use as a blocking control in assays to test for specificity of EIF1AX antibody, catalog no. 70R-5014 |
EIF1AX Blocking Peptide |
| DF12973-BP |
Affbiotech |
1mg |
EUR 195.00 |
 anti- EIF1AX antibody |
| FNab02685 |
FN Test |
100µg |
EUR 548.75 |
- Recommended dilution: WB: 1:200 - 1:2000
- IHC: 1:100 - 1:200
- Immunogen: eukaryotic translation initiation factor 1A, X-linked
- Uniprot ID: P47813
- Gene ID: 1964
- Research Area: Metabolism
|
|
Description: Antibody raised against EIF1AX |
anti- EIF1AX antibody |
| FNab02686 |
FN Test |
100µg |
EUR 505.25 |
- Immunogen: eukaryotic translation initiation factor 1A, X-linked
- Uniprot ID: P47813
- Gene ID: 1964
- Research Area: Metabolism
|
|
Description: Antibody raised against EIF1AX |
 EIF1AX Rabbit pAb |
| A5917-100ul |
Abclonal |
100 ul |
EUR 308.00 |
EIF1AX Rabbit pAb |
| A5917-200ul |
Abclonal |
200 ul |
EUR 459.00 |
EIF1AX Rabbit pAb |
| A5917-20ul |
Abclonal |
20 ul |
EUR 183.00 |
EIF1AX Rabbit pAb |
| A5917-50ul |
Abclonal |
50 ul |
EUR 223.00 |
 Anti-EIF1AX antibody |
| STJ27713 |
St John's Laboratory |
100 µl |
EUR 277.00 |
|
Description: This gene encodes an essential eukaryotic translation initiation factor. The protein is required for the binding of the 43S complex (a 40S subunit, eIF2/GTP/Met-tRNAi and eIF3) to the 5' end of capped RNA. |
 Mouse EIF1AX shRNA Plasmid |
| 20-abx975488 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) EIF1AX protein (His tag) |
| 80R-1475 |
Fitzgerald |
100 ug |
EUR 305.00 |
|
Description: Purified recombinant Human EIF1AX protein |
 Human EIF1AX shRNA Plasmid |
| 20-abx951359 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
) EIF1AX Recombinant Protein (Rat) |
| RP199280 |
ABM |
100 ug |
Ask for price |
) EIF1AX Recombinant Protein (Human) |
| RP010342 |
ABM |
100 ug |
Ask for price |
) EIF1AX Recombinant Protein (Mouse) |
| RP131189 |
ABM |
100 ug |
Ask for price |
 (pORF)) EIF1AX ORF Vector (Human) (pORF) |
| ORF003448 |
ABM |
1.0 ug DNA |
EUR 95.00 |
 (pORF)) Eif1ax ORF Vector (Mouse) (pORF) |
| ORF043731 |
ABM |
1.0 ug DNA |
EUR 506.00 |
 (pORF)) Eif1ax ORF Vector (Rat) (pORF) |
| ORF066428 |
ABM |
1.0 ug DNA |
EUR 506.00 |
) EIF1AX sgRNA CRISPR Lentivector set (Human) |
| K0664701 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
) Eif1ax sgRNA CRISPR Lentivector set (Mouse) |
| K4533601 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
 (pORF)) EIF1AX-AS1 ORF Vector (Human) (pORF) |
| ORF018775 |
ABM |
1.0 ug DNA |
Ask for price |
) Eif1ax sgRNA CRISPR Lentivector set (Rat) |
| K7575001 |
ABM |
3 x 1.0 ug |
EUR 339.00 |
 (Target 1)) EIF1AX sgRNA CRISPR Lentivector (Human) (Target 1) |
| K0664702 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 2)) EIF1AX sgRNA CRISPR Lentivector (Human) (Target 2) |
| K0664703 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 3)) EIF1AX sgRNA CRISPR Lentivector (Human) (Target 3) |
| K0664704 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 1)) Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 1) |
| K4533602 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 2)) Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 2) |
| K4533603 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 3)) Eif1ax sgRNA CRISPR Lentivector (Mouse) (Target 3) |
| K4533604 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 1)) Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 1) |
| K7575002 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 2)) Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 2) |
| K7575003 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (Target 3)) Eif1ax sgRNA CRISPR Lentivector (Rat) (Target 3) |
| K7575004 |
ABM |
1.0 ug DNA |
EUR 154.00 |
 (pPB-C-His)) EIF1AX Protein Vector (Mouse) (pPB-C-His) |
| PV174922 |
ABM |
500 ng |
EUR 603.00 |
 (pPB-N-His)) EIF1AX Protein Vector (Mouse) (pPB-N-His) |
| PV174923 |
ABM |
500 ng |
EUR 603.00 |
 (pPM-C-HA)) EIF1AX Protein Vector (Mouse) (pPM-C-HA) |
| PV174924 |
ABM |
500 ng |
EUR 603.00 |
 (pPM-C-His)) EIF1AX Protein Vector (Mouse) (pPM-C-His) |
| PV174925 |
ABM |
500 ng |
EUR 603.00 |
 (pPB-C-His)) EIF1AX Protein Vector (Human) (pPB-C-His) |
| PV013789 |
ABM |
500 ng |
EUR 329.00 |
 (pPB-N-His)) EIF1AX Protein Vector (Human) (pPB-N-His) |
| PV013790 |
ABM |
500 ng |
EUR 329.00 |
 (pPM-C-HA)) EIF1AX Protein Vector (Human) (pPM-C-HA) |
| PV013791 |
ABM |
500 ng |
EUR 329.00 |
 (pPM-C-His)) EIF1AX Protein Vector (Human) (pPM-C-His) |
| PV013792 |
ABM |
500 ng |
EUR 329.00 |
 EIF1AX 3'UTR Luciferase Stable Cell Line |
| TU006700 |
ABM |
1.0 ml |
EUR 2333.00 |
 Eif1ax 3'UTR GFP Stable Cell Line |
| TU155692 |
ABM |
1.0 ml |
Ask for price |
 Eif1ax 3'UTR Luciferase Stable Cell Line |
| TU203860 |
ABM |
1.0 ml |
Ask for price |
 (pPB-C-His)) EIF1AX Protein Vector (Rat) (pPB-C-His) |
| PV265710 |
ABM |
500 ng |
EUR 603.00 |
 (pPB-N-His)) EIF1AX Protein Vector (Rat) (pPB-N-His) |
| PV265711 |
ABM |
500 ng |
EUR 603.00 |
 (pPM-C-HA)) EIF1AX Protein Vector (Rat) (pPM-C-HA) |
| PV265712 |
ABM |
500 ng |
EUR 603.00 |
 (pPM-C-His)) EIF1AX Protein Vector (Rat) (pPM-C-His) |
| PV265713 |
ABM |
500 ng |
EUR 603.00 |
 EIF1AX 3'UTR GFP Stable Cell Line |
| TU056700 |
ABM |
1.0 ml |
EUR 2333.00 |
Eif1ax 3'UTR Luciferase Stable Cell Line |
| TU105692 |
ABM |
1.0 ml |
Ask for price |
Eif1ax 3'UTR GFP Stable Cell Line |
| TU253860 |
ABM |
1.0 ml |
Ask for price |
 Recombinant Human EIF1AX Protein, His, E.coli-1mg |
| QP11763-1mg |
EnQuireBio |
1mg |
EUR 2757.00 |
 Recombinant Human EIF1AX Protein, His, E.coli-20ug |
| QP11763-20ug |
EnQuireBio |
20ug |
EUR 201.00 |
 Recombinant Human EIF1AX Protein, His, E.coli-5ug |
| QP11763-5ug |
EnQuireBio |
5ug |
EUR 155.00 |
 (CMV) (pLenti-GIII-CMV)) EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV) |
| LV639421 |
ABM |
1.0 ug DNA |
EUR 514.00 |
 (UbC) (pLenti-GIII-UbC)) EIF1AX Lentiviral Vector (Rat) (UbC) (pLenti-GIII-UbC) |
| LV639425 |
ABM |
1.0 ug DNA |
EUR 514.00 |
 (EF1a) (pLenti-GIII-EF1a)) EIF1AX Lentiviral Vector (Rat) (EF1a) (pLenti-GIII-EF1a) |
| LV639426 |
ABM |
1.0 ug DNA |
EUR 514.00 |
 Antibody) Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody |
| 20-abx004534 |
Abbexa |
- EUR 411.00
- EUR 592.00
- EUR 182.00
- EUR 314.00
|
- 100 ul
- 200 ul
- 20 ul
- 50 ul
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody |
| 20-abx112356 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody |
| 20-abx320527 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody |
| abx232685-100ug |
Abbexa |
100 ug |
EUR 509.00 |
- Shipped within 5-12 working days.
|
Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) Antibody |
| abx232686-100ug |
Abbexa |
100 ug |
EUR 481.00 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV)) EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV) |
| LV723941 |
ABM |
1.0 ug DNA |
Ask for price |
 (UbC) (pLenti-GIII-UbC)) EIF1AX-AS1 Lentiviral Vector (Human) (UbC) (pLenti-GIII-UbC) |
| LV723945 |
ABM |
1.0 ug DNA |
Ask for price |
 (EF1a) (pLenti-GIII-EF1a)) EIF1AX-AS1 Lentiviral Vector (Human) (EF1a) (pLenti-GIII-EF1a) |
| LV723946 |
ABM |
1.0 ug DNA |
Ask for price |
) EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) |
| K0664705 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse) |
| K4533605 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector set (Rat) |
| K7575005 |
ABM |
3 x 1.0 ug |
EUR 376.00 |
 Antibody) Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) Antibody |
| 30196-05111 |
AssayPro |
150 ug |
EUR 276.00 |
 (Target 1)) EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1) |
| K0664706 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 2)) EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2) |
| K0664707 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 3)) EIF1AX sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3) |
| K0664708 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 1)) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1) |
| K4533606 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 2)) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2) |
| K4533607 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 3)) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3) |
| K4533608 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 ELISA Kit) Human Eukaryotic Translation Initiation Factor 1A, X-Chromosomal (EIF1AX) ELISA Kit |
| abx387079-96tests |
Abbexa |
96 tests |
EUR 911.00 |
- Shipped within 5-12 working days.
|
 (CMV) (pLenti-GIII-CMV-C-term-HA)) EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-C-term-HA) |
| LV639422 |
ABM |
1.0 ug DNA |
EUR 514.00 |
 (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)) EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
| LV639423 |
ABM |
1.0 ug DNA |
EUR 572.00 |
 (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)) EIF1AX Lentiviral Vector (Rat) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
| LV639424 |
ABM |
1.0 ug DNA |
EUR 572.00 |
 (Target 1)) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 1) |
| K7575006 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 2)) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 2) |
| K7575007 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 (Target 3)) Eif1ax sgRNA CRISPR/Cas9 All-in-One Lentivector (Rat) (Target 3) |
| K7575008 |
ABM |
1.0 ug DNA |
EUR 167.00 |
 EIF1AX Eukaryotic Translation Initiation Factor 1 X-linked Human Recombinant Protein |
| PROTP47813 |
BosterBio |
Regular: 20ug |
EUR 317.00 |
|
Description: EIF1AX Human Recombinant produced in E.Coli is a single, non-glycosylated polypeptide chain containing 150 amino acids (1-144a.a.) and having a molecular wieght of 18.6kDa. EIF1AX is fused to 20a.a. His-Tag at N-terminus and purified by proprietary chromatographic techniques. |
 (CMV) (pLenti-GIII-CMV-C-term-HA)) EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-C-term-HA) |
| LV723942 |
ABM |
1.0 ug DNA |
Ask for price |
 (CMV) (pLenti-GIII-CMV-GFP-2A-Puro)) EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-GFP-2A-Puro) |
| LV723943 |
ABM |
1.0 ug DNA |
Ask for price |
 (CMV) (pLenti-GIII-CMV-RFP-2A-Puro)) EIF1AX-AS1 Lentiviral Vector (Human) (CMV) (pLenti-GIII-CMV-RFP-2A-Puro) |
| LV723944 |
ABM |
1.0 ug DNA |
Ask for price |
 Antibody (Biotin Conjugate)) Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) Antibody (Biotin Conjugate) |
| 30196-05121 |
AssayPro |
150 ug |
EUR 369.00 |
 AssayLite Antibody (FITC Conjugate)) Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (FITC Conjugate) |
| 30196-05141 |
AssayPro |
150 ug |
EUR 428.00 |
 AssayLite Antibody (RPE Conjugate)) Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (RPE Conjugate) |
| 30196-05151 |
AssayPro |
150 ug |
EUR 428.00 |
 AssayLite Antibody (APC Conjugate)) Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (APC Conjugate) |
| 30196-05161 |
AssayPro |
150 ug |
EUR 428.00 |
 AssayLite Antibody (PerCP Conjugate)) Human Eukaryotic Translation Initiation Factor 1A X-Linked (EIF1AX) AssayLite Antibody (PerCP Conjugate) |
| 30196-05171 |
AssayPro |
150 ug |
EUR 471.00 |
Advances within the cultivation strategies, success in gene cloning and expression, metabolic engineering, metagenomics, and different associated strategies are considerably contributing to develop the appliance horizon of those outstanding organisms of the ‘weird’ world. Research have proven the big potential of alkaliphiles in quite a few biotechnological purposes. Though it appears only the start, some unbelievable strides are already made in tapping this potential.
This work tries to overview a number of the outstanding purposes of alkaliphiles by focusing akin to on their enzymes, metabolites, exopolysaccharides, and biosurfactants. Furthermore, the chapter strives to assesses the whole-cell purposes of alkaliphiles together with in biomining, meals and feed supplementation, bioconstruction, microbial gasoline cell, biofuel manufacturing, and bioremediation.
